HPDSCs contain a significantly greater amount of CD34+ hematopoietic stem/progenitor cells compared with donor\matched UCB (Fig

HPDSCs contain a significantly greater amount of CD34+ hematopoietic stem/progenitor cells compared with donor\matched UCB (Fig. Radnor, PA) was collected from each placenta. After reddish blood cell depletion using Hetastarch and volume reduction, the cells were cryopreserved in a solution containing 5% human albumin and 10% dimethyl sulfoxide with a controlled rate freezer prior to final storage in the gas phase of a liquid nitrogen tank. Viability of the HPDSCs was decided using 7\aminoactinomycin D (BD Bioscience, San Jose, CA) by circulation cytometry. Colony Forming Cell (CFU) Assay CD34+ cells were selected from HPDSCs with a human CD34 positive selection kit and isolated using automated cell separator RoboSep (StemCell Technologies, Inc., Vancouver, Canada). The CFU assay was performed using MethoCult, following the manufacturer’s protocol (StemCell Technologies, Inc.). Briefly, CD34+ cells were mixed with total MethoCult medium supplemented with stem cell factor, granulocyte colony\stimulating factor, granulocyte\macrophage colony\stimulating factor (GM\CSF), interleukin 3, interleukin 6, and erythropoietin (Epo) and plated in triplicate at a density of 100, Fraxinellone 300, and 1,000 cells per 35 mm plate, respectively. After 2C3 weeks, the culture was evaluated for colony formation and scoring using an inverted microscope and a scoring grid. Flow Cytometry Analysis Flow cytometry analysis was performed to compare the immunophenotypes of HPDSCs from six placentas with donor\matched UCB. Post\thawed HPDSCs and UCB were resuspended in phosphate buffered answer (PBS) Rabbit Polyclonal to Tau with 2% fetal bovine serum at a density of 1 1 106/ml, incubated with conjugated antibodies (Table ?(Table1)1) according to a standard protocol, and analyzed using BD LSRFortessa Fraxinellone (BD Biosciences). To investigate the in vivo trafficking of HPDSCs, peripheral blood and organs including lung, spleen, bone marrow, GI, and skin were isolated from your recipient RDEB mice on different days Fraxinellone after HPDSC administration. Following lysis of the reddish blood cells from your peripheral Fraxinellone blood and mechanical dissociation of the organs, single cell suspension was immunostained with anti\HLA\A, B, C antibody (Biolegend, San Diego, CA) and analyzed using MACSQuant Analyzer (Miltenyi Biotech, Inc., Auburn, CA). The level of human cell persistence was offered as an average percentage of HLA\A,B,C positive cells of the total single cell suspension from peripheral blood or organs of biological repeats. Table 1 List of the antibodies used in this study. primers were utilized for PCR amplifications: F1, TGACCCACGGACAGAGTTCG, R1, GATCAGGATGCAGACCTTGG; F2, GGCTTCTGGGCTTAATGTG, R2, GGGCTGAGTAGTGAAGGAT, as previously reported 24. HPDSC Administration in test was used to determine the difference in the percentage of subset populations between HPDSCs and UCB as well as the separation at DEJ at the basement membrane zone the WT, untreated RDEB, and HPDSC treated RDEB mice. A value? ?.05 was considered significant. Results HPDSCs Are Rich in Both Hematopoietic and Nonhematopoietic Stem Cells The overall cell types as determined by flow cytometry analysis are comparable between HPDSCs and UCB. In both cell sources, greater than 80% of the cells are lymphocytes, monocytes, or granulocytes. Among the remaining cells, several different cell types are recognized, including hematopoietic stem cells, mesenchymal stem cells (MSCs), megakaryocytic precursors, and endothelial progenitors. HPDSCs Fraxinellone contain a significantly greater amount of CD34+ hematopoietic stem/progenitor cells compared with donor\matched UCB (Fig. ?(Fig.1A).1A). Specifically, a subpopulation of cells with a phenotype of CD34+/CD45? was observed in a significantly higher concentration in HPDSCs than UCB (1.9% vs. 0.1%, expression (Fig. ?(Fig.3A3A and data not shown). Surprisingly, in contrast to a complete absence of C7 in the newborn untreated RDEB skin, a continuous C7 staining appeared at the DEJ of the paw skin of 1\ and 2\week\aged HPDSC\treated RDEB mice (Fig. ?(Fig.3B).3B). In the paw skin of 7\week\aged HPDSC\treated RDEB mouse, C7 was mostly recognized in patches, particularly at or close to the region with dermal\epidermal separation. The C7 staining was much less intense in the HPDSC\treated RDEB mice that survived over three months (12, 14, 15, and 16 weeks, respectively), but it was still detectable particularly close to the dermal\epidermal separation (Fig. ?(Fig.3B3B and data not shown). Open in a separate window Physique 3 HPDSC.